Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E426898

Search information 
Request: 426898Match: SGN-E426898
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276706Clone name: STM-47-I24
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276706 [STM-47-I24] Trace: SGN-T279034 EST: SGN-E426897 Direction: Unknown Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E426898Length: 749 bp (915 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E426898 [] (trimmed) TTCTTTTTTTAATGCAAACTCATGACTATTTTATTTCATATATTAGTGAAAAGATCCAACATAATGACTTTGGGAATGGAGTGTCAGCTAACCTC
CTAATTATACACATTGAACAGTGACAATAGCAAACGATTCAAAAAACAGATCATATATCCTCTACTCAGGTGTCCTTTATATGCTACATGAATCT
TGGATCCCTATGCTGTATGCATGATCATATTCTACTACTTCTTGGTATATTGATGCTTAATCGCTCATCGCCCAGAAAGCTTAACCATCCATGCT
CCACCCAAGTAAAGACCCAAAAGAGGGCCAGCTAGAAGCATTTGAGTAAGGGGATCAGTTGATGGTGTGAGCACTGCAGCAGCAACAACAGCACC
TACCACCACGTATCTCCAAATCGACAGCATTTGATCTCCGGACACAAGACCAGTTTGTCCCAGAAGCAGTTGAATGACAGGAACCTGGAAAGACA
ATCCTGTACTGAACATGAGTACGAGCACAAATTCAAAGTATTGATCAATGGACCAAAAAGATTCCACAGCCCCTTCTGCATAATTAACAAAGAAA
TTCAAGGCTGCTGGAGTGAGAACCAAGTGTGAGAAAACAATGCCGGCGTAGAAAAGCACAGAGGATCCAAGGACAATTGGTGCCAGGAATCTTCT
TTCTGACATTGTTAAACCAGGAAGACAAAGGCTATGATCTCGTAGAGAATCACAGGAGCTCCTAAGAGAGGCCACTATATCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E426898] SGN-U294191 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279035 [Download] [View] Facility Assigned ID: STMHD60TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5