Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E427466

Search information 
Request: 427466Match: SGN-E427466
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C276901Clone name: STM-48-D13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C276901 [STM-48-D13] Trace: SGN-T279604 EST: SGN-E427467 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427466Length: 450 bp (943 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E427466 [] (trimmed) GCGCGGTGAACGACAGCTCCATTTCGAGATCTACCTATTCGAATTCTCCGATCGCCGGTCGCCGGTCACCGGTCTCCGACATCCGGTTAGCCGTC
GTCGTCTCTTCCCTTACGAATGTTTTTTCTCTCTCAAAGGAACTAGTTTGACATTCATCTTCATTAAGATCGATCTGCCTTATAGGTCGTAATTT
GTTGATTTCTAGATGTTATTCCGATGCTCTTAGAAAAAAAATTTGTCCCACTAATTGATCCTCCAACTTTGAAAAAAAAAAATGAGGTGGATCAA
AAGTCAAACGTGCATTGGTGGACAGAGTTAGCCGGTAACTGTAGTTGATAGGGATACTGTGGAATTGGTGCACCACAAGCTGGCCTGGATACCGT
GGTTATCAATTAACTAAAATAAAGCATAGATGCAGATGTAAGCAATGGAAGTGTTGAATGTTTTTTTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427466] SGN-U286761 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279603 [Download] [View] Facility Assigned ID: STMHI19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5