EST details — SGN-E427751

Search information 
Request: 427751Match: SGN-E427751
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277233Clone name: STM-49-E11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277233 [STM-49-E11] Trace: SGN-T279887 EST: SGN-E427750 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E427751Length: 556 bp (894 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E427751 [] (trimmed) GGGCCCCCCCTCGAGTTTTTACAACACTATTTTTTTTGAAAGGGACATATCCTAAATAATTCATTTTGTATTCTCAATGCAAATTTTCTGTCTCC
CTTGATCAATTAACAGTAAGTAACACTCACATTATTTGTCATCAACCTCTTACAGAATAGCAACCAGAATCTGGTATTTATGTTAAACAGGCTTT
GAAGCCCTCCTCTAATTCCTTAGCATCTAAGTTCTTCCCTATAAATACTATCTTGTTTGTTCTTGGTTCATCCGACTTCCATGGCCGATCTGGAG
AACCTTGAAATATGTCATGGACTCCCTGAAAGACAAATCTCTCATCCATTCCCTCAACAGATAAAAGACCCTTCATCCGATATATGTCATCGCTT
CGTTCCATCAGCAACGTTCCCAACCACATATTAGCCTTCTCAAGATCCAAGGTCCCTTCACAAACTATGCTGACAGAAGAAACACCAGGGTCATG
AGTATGATCGTGAGAATGGTGATGATCATGATGCTCATGCTTGTGATCATGTTCATGTTCATGGTCATGGTCATGGTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E427751] SGN-U275965 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T279888 [Download] [View] Facility Assigned ID: STMHK30TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0070 Quality Trim Threshold: 20.5