EST details — SGN-E428077

Search information 
Request: 428077Match: SGN-E428077
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C277420Clone name: STM-49-N5
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C277420 [STM-49-N5] Trace: SGN-T280213 EST: SGN-E428076 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E428077Length: 460 bp (888 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E428077 [] (trimmed) CAACAAACAAAGAGGTTTTTTTTTTTTTTTACTCCAATTTCCTTTAAGAAAAAGATGAAAATCTTGACAAAAACTTTGTATTATTCACCGTATTA
TATACAATCTCTGTGCTACACAATCACACGCTGAATAGTACACCAAAAACACAAACCTTCCACTGTCACAATATCCCAGCTTATGATGCAGCTTC
GTTGACCTTAATCTCCAAAAGTTCCTCAATGGGTTGGCGGCATATGGGGCACTTATTTGATTGATGCCTCAGTTCTTTGGCACACTCACCACACA
AACACATATGTCTACATGGCAAAACTGCCGTGTCTTTCTGCTCAGTCATGCAAATTACACATTCTTTTCCTGACTCCTCATCATTGACATTAATT
TCCTCTGAATTGTTGATCCCATAAATCTCTCTGAGCTCATAACGAACTCCTTCAATCCATAAAATCTGCTTGATCACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E428077] SGN-U291048 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T280214 [Download] [View] Facility Assigned ID: STMHM75TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5