EST details — SGN-E429190

Search information 
Request: 429190Match: SGN-E429190
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278013Clone name: STM-51-L7
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278013 [STM-51-L7] Trace: SGN-T281326 EST: SGN-E429189 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429190Length: 714 bp (950 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429190 [] (trimmed) TTTTTTTTTTTTAGCCTCGTCCAATAGTCGTATATAAAAGGGGAGAGAACTCGTGGCATTGTTTTTAGGCAAACTTTCTTTCTTCCACACATGTG
GTGCTGCTCTTAGTTCATCTGTGAAGAGACTCAAACCTAGAATACTGGAATGCAAGGATCTACAATACTAACTCTCACAAACATCCATGCCAAAG
TCTAAAGTCAATGACTAGTAGGCACTTGCACTCAAGAAACTCCTTCAAGGACATTTTTCAGTTTTTCATTAGCCGCAACAAGTTCTGCTGCTATT
CCTGGTTCATTTGCCGAATGACCTGCTCCTGGGACAACAATGAACTCTGCCTCTGGCCAAGCTTTATGAAGATCCCATGCTGACATCATTGGACA
GCAAACATCATATCTTCCCTGAACAATTATTGTTTTGATATGCTTTATCTTTTCAACATTATCTAGAAGGAAAGAATCTGAAGAGAAGAATCCCT
TGTTGATAAAGTAGTGGTTCTCAATCCTTGCAAATGCCAAGGAGAAATCATCATCATCTCCTCTCTTTATGTTCTCTTCATTAGGGAGAAGATGA
GAGGTCATCATTTCCCATTTAGTCCATGCCCTAGCTGCTGCATACTGTGTTTCTAGGGTATCTGAATTTAATCTCTTATGGTAAGCCTTGACAAA
ACACTTCCTTTCTTCCTCTGGAATCAGATCTCTGAATGGCTCCCAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429190] SGN-U273244 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281327 [Download] [View] Facility Assigned ID: STMHU64TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5