Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E429536

Search information 
Request: 429536Match: SGN-E429536
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278112Clone name: STM-52-A4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278112 [STM-52-A4] Trace: SGN-T281672 EST: SGN-E429535 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429536Length: 515 bp (864 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429536 [] (trimmed) TCGAGTTTTTTTTTCCTTTTTTAAAAAAAGATGATATGCTCTTGCACAATTATTCTTTTTTTTTTTTCCTTTTTGGGGTACATTTTTTTTTTCTT
GGATACAAACACTGTCGGCAGAAAAAAAAAACAAACTTAAATACAAATGAAAAAATTGATAGGTAATTACAGTATTTATAACAAAATAAAACAAA
AGATATTTTCTCCCTTCTCTTGCTTCTTCTTTTTTTTTCTACTTCAATTCCAAGCATTTTTGTCCTTCCTTGCCCATTTTATGTTTTATCATATG
ATCACATAAGCCCTCCTAATAACATGCTTTTTTTCATTTCTTTATCTTCAGAAGTTCCTCAAGTATACAAATTTTAATGACAACTAGCAAAAGCA
AATGACCCCATTGTACCACATACTACTTCCATCAACTTTCCTCTTCTTGGCTTTGCAACAACTTTAGCAACAGGAGCAGCTATAGGAGCAGCCTT
AATTTCCTCAAGAGGGAACAAAACACCATCAACCCCTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429536] SGN-U271119 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281673 [Download] [View] Facility Assigned ID: STMHX02TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0055 Quality Trim Threshold: 20.5