Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E429566

Search information 
Request: 429566Match: SGN-E429566
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278153Clone name: STM-52-C20
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278153 [STM-52-C20] Trace: SGN-T281702 EST: SGN-E429565 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429566Length: 781 bp (900 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429566 [] (trimmed) TTTTTTTTTGAAGGAATTTTATTATAATAAAACAATAACATATCATGCTTATATAGTACATCTAATACAGATCAAGTAAAATCAGTCAACATGAC
TGGATAATCTTGAAGTTTATTAACGATTACAAATAAAAACCACACAAATTAATAATTATAGCACCTTAGTTTGGCTTATACTAATTTAGTTGTTA
TCCCACCAGAATTGTGATTGGAGATAATCCACAACTTTCTTATCAACTTGGAATGCTTTAGAGAGGATATCGTCATTGATTGGTGGGTCTGAGCC
AAATACTGCATTTGCAATAGTGATGACTCCTGGATTTTGACTACTAAGTCCAGCAAATGCAACTGCCTTAGTTTTTCCCACGTTGAATTGAAAAT
GAATGAGACCTATTGGAAAAACAAACACATCTCCAGGATGTAGAATCTTGGTAAAGAGCTTGTTCTTCATGTTTGGACCCGGGTTTGAAAGGACA
AAACCAACATAGAGTGTGCCCTCAAGGACCGTAAGAACCTCGGTTCCTCTAGGGTGTGTATGTGGTGGGTTGAGACCGTATGGTGCATAGTCAAT
ACGAACTAATGAAATGCCCAGAGTGTTGAGCCCTGGTAAATTGTTAACATTCACAGCAGTTACTGCAGATCCAACATTATTTGAAGTATTTCCAG
CTACGTTTAAGCCTGATTTGAAGAAGTCATTAGCAGTGACCCTCGTGCCGAATTCGGCACGAGGCTAAAAAACACCATTGATGAATCATTCTTGT
ACAAAAAATCGAAAAAACTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429566] SGN-U268758 Solanum tuberosum Build 4 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281703 [Download] [View] Facility Assigned ID: STMHX22TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5