Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E429710

Search information 
Request: 429710Match: SGN-E429710
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278167Clone name: STM-52-D13
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278167 [STM-52-D13] Trace: SGN-T281846 EST: SGN-E429709 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429710Length: 720 bp (888 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429710 [] (trimmed) CGGGCCCCCCCTTTTTTTTTTTTACCTTTTTTTTTACAAAAAAAATATTATACTTAAATATGTTTTACATTGCAAGCAATGTAGCAACTAACCAA
CAACCACAAGTAATTTGAACCATGGGATTTCATTAACAAGAAAAAACATGAAAAGGGAAAGAAATGCAGGATATTTTTCAGAGATTAATCTTCTT
TCTATCCAAAATAACCAAATGGTGTTTAACAACTATACTCCAGATATAGGTAAGTGAGCGACAAGCGAGAGCAGAGTCTAATTGATGATCTAAGC
CTTGTTTGAAATATTGTTCGATAGCCAATCAAGTCCCTCGTATAACCCTTCTCCAGAGGTGGCACATGCACTCTGGATATACCAGTGCCGCTGTC
GAAGAGAATGAAGTCCAAGTTTATCGGTGATTTCAGCCGCATTCATTGCGTTTGGAAGATCTTGTTTGTTTGCAAAAACAAGCAGCACAGCCTCT
CTTAGTTCATCCTCATTTAACATCCTATGAAGCTCATCCCTTGCCTCAACAACACGGTCTCTGTCATTGCTGTCAACCACAAAGATGAGGCCTTG
TGTGTTCTGGAAATAATGCCTCCATAGAGGTCGAATCTTGTCCTGGCCCCCAACATCCCACACGGTAAAGCTGATGTTCTTGTATTCAACTGTTT
CCACGTTGAAGCCAATTGTAGGTATAGTGGTAACAATTTCCCCCAACTTGAGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429710] SGN-U286763 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281847 [Download] [View] Facility Assigned ID: STMHY19TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5