EST details — SGN-E429713

Search information 
Request: 429713Match: SGN-E429713
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C278171Clone name: STM-52-D17
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C278171 [STM-52-D17] Trace: SGN-T281849 EST: SGN-E429712 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E429713Length: 779 bp (899 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E429713 [] (trimmed) TTTTTTTTTTGAAGAAAGATTTTGAAATGTACCATAAATCAGCTTGTCATGTGAGCATATATAACCTCATCTCATTTATACATGAAATAAGATCC
TAATAAACATTAGTTACATCCTAATCTCCTGCCCCTTACAGCTTGAAATATCAAGAATCATGTCTACCTTTGATTAATAGACAAGTTCTACTTTG
AATTGTAGGAATTGAAGATATATCAAGCAAAAGTAGAATCTCAACAGGGAGTGAACTCATGGAAGCTACACTAAGATATCTCTCATCAACCATTT
GCTTTAAAAAGTTGACGAACGCTATTATAAAAATATCGTAGTATTATCAGGAATCTAATATTATAACTTCCTTATCTTCCATGGATCTGCAAGTT
TCTTCCATCAAACTGCTACTCCTTGCTTCTGTACCACCAATTGCATTTTCTTCCCTGCTTCCTTCGGGATCCATGCATTCAATTTCTTCTACGTC
TTGTATTACTTCAAGAAGCTCTCCAGGCATAGCTGCTGGATCCAACTCTCGAAAACCCTTGGGAGTGTTTGGGGCTTCTTTTCCAGTAAGCAAGA
ACGATGAAATCTCATGAGAAAATCGATACATTTCTTCCTTAGGAATTTTTCTTATTTCCCTGGGGTTCAAATGCTTGTGGAACACTGACTTGAAG
CCAGCAACTTTGACGAGAGGAGTAACTACCACAACTTCCTCATTAAAATCTTCAAGTACTTCAATCAAATCATATTTGTGTATTACATCATCCTC
TGTGAACTCATTCCATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E429713] SGN-U297584 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T281850 [Download] [View] Facility Assigned ID: STMHY21TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5