EST details — SGN-E431266

Search information 
Request: 431266Match: SGN-E431266
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279421Clone name: STM-55-O3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279421 [STM-55-O3] Trace: SGN-T283402 EST: SGN-E431265 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431266Length: 327 bp (874 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E431266 [] (trimmed) ACAACTTTTTTTACTAACACCAAGGAATCTTTTTTGTGAAACTTTTAATTACTCTCCACGTGTATGGAAAAAAAAAACAATTAGATAAGCATCAG
TACGATGCTTAGAAATACAAATTACACTGTTAATGAAAAAGAATATGCAAATTGAACACTTGTATTAGTTGTCTTGGTCAGAATTGGATAGCCTG
TCTTCTGAATCCAGATAATGATGTCTAATGATAATCTGAATTCTTGTGATTAACATTAGTATAATGTACATAGGCAAGAATATTCCAGTGGATTT
AATAATTAACCATGTAAGAAGTGGAAAGGGATAATTTTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431266] SGN-U277057 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283403 [Download] [View] Facility Assigned ID: STMII86TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0171 Quality Trim Threshold: 14.5