Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E431310

Search information 
Request: 431310Match: SGN-E431310
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279161Clone name: STM-55-C2
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279161 [STM-55-C2] Trace: SGN-T283446 EST: SGN-E431309 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E431310Length: 457 bp (881 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E431310 [] (trimmed) CCTTTTTTTTTTTTTTTTTTTTTTTTTTTTGACAAATTCCTTATTCATCAATCTGACATTTGCTGGGGGTTAAAAAAAACAAAACAATCTATCTA
AGTTTTGAACTATATTTCATAGCTGACATTTTGAATAAAATTTGAGAAAATTATGAACTTTTCCAAACAGTTTGTCTTAAACTTTTGTTCAAGGG
TTGGAGGGGGCAAAAACAACCACTGAATTATGTCCTCCGAATCCGAACGAGTTGGAGATACCAACATTCCCTTCATGGTGGTTCTTCACATTTGG
AACGGGGGCAATCGTGACCTGGGGGTCTAATTCATATTGATTGATGGGTGGAAGAAACCATCCCGGTTTGATTGCCCTGATGGGTGCAATGGCTT
CAATTCCACCAGCAGCCCCCAGTCCATGACCGATAATCCACTTTGGCCCGGTCATTTTGATTTCCCAGGGATCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E431310] SGN-U294822 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T283447 [Download] [View] Facility Assigned ID: STMIJ13TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0191 Quality Trim Threshold: 14.5