EST details — SGN-E432114

Search information 
Request: 432114Match: SGN-E432114
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279565Clone name: STM-56-F21
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279565 [STM-56-F21] Trace: SGN-T284250 EST: SGN-E432113 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432114Length: 796 bp (844 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432114 [] (trimmed) CATCTTTTTTTCATGCAACTCCAATAATTTACTATTAGCGTTTGTAATTGCAACATAAGTCTGAGGCTCGTCGCTGTCTCAAGATTGACAACCTC
GTAAATATACGTAAGACATAGGTCCAACAAAAATTGTAAATATCCAACAGATGGGGCTGAATTATACTAAGTAAATTTACAGGTTTGGATGTGCC
CTCCCTAGATGTAGCTTTATGGGAAGAACGCAAGAACTCAGACGTCAGTAAAACGAGTTTTCTCATTTATGTTTGACGGTGATCCTTCCCACAGC
TCCGCTAGCTCCTTTCGCATCCATGAAATGACAATTATCGGCCCCAAAGTTGATGGTACCAAGTATAGAAGTGCTGGTTGTGGCGAGTGAGTCAA
AATACCAGCTGCTAAGGCAGTAACCAGTCCAAGGGAATATCCTGCTAGCGCATACCATATGTAAAACCCCTTTGGAGATGATATCTCCTCCTTTG
GAGGCGGTATATCCATGATGTTTTCAGAGTCCTTGCTCTTTCTATGGTCAAAACAGAGAACCAATGCTAAAAGCATCGAAGGAATAGCCATGTCA
CCAAGACCCAGCATCATGAAATCAACAGCAGCATATCCAGGCACTACACCACCCAGTAAATTTCTGGGGAACACAATCTTGACAGGCAACTCGAG
TTTTTTTGGTTATCAACTGCAATCCAGGAAGGCTCAATCTATTCGCCACTATGTGTACAGGATTGGATGATTGCTGGGTTGCTACAGACACCATG
ACATTTGCGCCAAAGAATCTCTCGGAATAGAAAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432114] SGN-U284982 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284251 [Download] [View] Facility Assigned ID: STMIO35TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5