Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E432476

Search information 
Request: 432476Match: SGN-E432476
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280006Clone name: STM-57-I3
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280006 [STM-57-I3] Trace: SGN-T284612 EST: SGN-E432475 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432476Length: 786 bp (821 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432476 [] (trimmed) TTTTTTTTTTTACTGAATTCACATCATTTATATAAATTCAATAATGTTTTAAAAATCCATATACAAAATCCGGGCAAAAACTATTTGAGTTCATG
TGTTACCTTGCGGCTCTGCCCCACGAAGCATAAATCGACATGGCATAGATGTTTAGTATTTTGTGCAGGAAGAATAAAATGCATTCCCAGTTACA
CATATTTAAAAGTTACAGTCCCTTATGCACATAATATGATTTAACATATCTTCATTACTGTCTGTCGATATCTAGAGGACCAAACAAACTACAGT
TGGTGTTCAAGTATGTGATGTTGTAGTACATTTCTAAGACTACATGCTCTTACATCTCAGCAGTAAACGATTTTCCACAACCACAAGTTTGCGTA
GCATTTGGATTTTTGAAAGAGAAGCCCCCGCCTATCAATGCATCGCTGTAGTCCAGTTGCATTCCGAAGATGAAGAGAAGGCTTTTTGGATCACA
AACAATAACAAATCCATTGTACTCAATGATTGAATCATCTGGTCTAGCATTTTCTCGCTTTTCAAACTCCATCGTGTATGACATTCCCGAGCATC
CCCCTTGTTTAACGCCAATTCTAAGACACAAGTCCTCATTCCGATCATTCCTCATTTTATTCAAGTGCATTAATGCATTGTCAGTTAAGGAAATT
GCAGGTTCTACTCCTCCAGATGCAGGTGCTGCTTCAAGTGTAGCAGATCGAATAGACAATGTTTTTTTGCGATTAAAAAACGAAGGCGCTCTCTC
TCTCTCTCTCTCTCTCTCTCTCTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432476] SGN-U279681 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284613 [Download] [View] Facility Assigned ID: STMIQ50TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0040 Quality Trim Threshold: 14.5