EST details — SGN-E432569

Search information 
Request: 432569Match: SGN-E432569
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279810Clone name: STM-57-A16
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C279810 [STM-57-A16] Trace: SGN-T284705 EST: SGN-E432568 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432569Length: 605 bp (824 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E432569 [] (trimmed) TAATTATAATGACATGTAAATGTTAATATTACATCTTTGCAAAATAGAGTACACTACAGAATGACCAGACGCAAATGGCAGAGTTTGGAATGTAT
GTCGGCTCTTCTGTCAGTCGCGTCAGGTCTGCTGCTCAGTTGAAAACTAAGAAACAAGTCTGAGGTCAACTAGTGCTGCCCGAGAGATCTCCTGA
AAGCGCACTTCCGTATGATGCTGATCCTGTGTATGAACTAGTAACTCGAGACGAATTACCAACACGGTTTTTTTGTAATTGGCGAATCTTGAAAA
GATCTCTAGGAAGGGGCTGGCTTTGTATAGTCGTTGATTCATCATCCTCTTGTCTGTCCATGTCTTTCCTCTTTCCCGGCTGTCTGTCTCTCGGC
CTGAATTTGCTTGAATCAGAGAGGTCACTCGTAGATGGAGCAGCGCCTGACTGCAAAGGCAGAGAGGCAGTCCCGGATTTTCCAGTTGCTGCAGG
GATGTTGCTTTGCAAACATACAGATATCACAAAATCAGCATCAGGAGAAGGACCTTCAACAGCTGGCAAATTTGCTATGAACGCTGCAAATGCAG
GGGGTAACGATTTCAAAATATCATTAAGGGCATTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432569] SGN-U292811 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T284706 [Download] [View] Facility Assigned ID: STMIR08TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0023 Quality Trim Threshold: 20.5