Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E432948

Search information 
Request: 432948Match: SGN-E432948
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C279939Clone name: STM-57-F4
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E432948Length: 687 bp (816 bp untrimmed)
Status: Current VersionDirection: 3'
>SGN-E432948 [] (trimmed) TTTTTTTTTTTCCGCTAATGTCCTTTAATGATCTTGAATGCTTTACAGATTCATCAGAAACAAGTACAAATATTATAATGTACATATACATGTAC
TCTTCTTCATGCACTAATACACTTTTTGGGTCAAGAAGATTTTTATCTATTGGATTCACAGCTCTGAAAACATGCTGCAGAACAGAAACCTTTTC
TTGACATTTCTACAATTCTTAGTTATAGTATACATAATCATCTCAAAAACATCTTCAAGAGAATAGTTTTCATTCCAAGCCAAAACCTGACATGA
TCGATAACATCTTTGTGATTGTTAATAGCAGAAGGAAAGGTTACCTCGATAATAGAAGCAGGAATGGTTACATAGCCTGCCTCAAAGAGTAGTTG
CCTCTTTAGTATCTACAGGTTCCTTAAATTTTGCCTTTTCACTGAGCTCTTGAAATGCATTTAGAAGATTCTGAAGTCTTGCAACAAACTCAATC
AACAAGGACGTAAATGTTGACAGTGATAATGTACTAGCACTTTCAAAAGTCCGTACTTCACGTTCGTTTAAAATCACATCTCCAATGAGTGAAAG
CCGTGAAGGCCACATTGTCTGCTGCGCGAATACATCTGCTGAGGAACCCCATTGTGAAGTAGAAAAGTTGACACTTACATTTGGATTAAGAGTAT
CCATGTGTTTCAATGTGTGAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E432948] SGN-U289717 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T285085 [Download] [View] Facility Assigned ID: STMIT26TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0045 Quality Trim Threshold: 14.5