Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E433306

Search information 
Request: 433306Match: SGN-E433306
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C280276Clone name: STM-58-E10
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C280276 [STM-58-E10] Trace: SGN-T285442 EST: SGN-E433305 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E433306Length: 567 bp (839 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E433306 [] (trimmed) CGGGCCCCCCCTCGAGTTTTTCAAAATCAAAATGTGTGGTTTTTTTTTCCTTATACACCATACAATAACACAACAACTAATAATCTCAGGTCACA
AAATTTTGCTTATAGTTTTATGCATAAATAAAATTTCAAAGTCATAGTAATAATCTATATCTCCTACTAGAAGCAATGTTGTTCCTGACTGTCAA
TTCTTATCAGCCCTATTATCAAACCCAAGAACAGGGCTTGATACTTGACGAAATTAAGTACTGTTATCTACTGAAAAAGAGTATCAAATTACTGT
TGTGCACATTGCACTCTCTGTGCACCACCACCATGCATATCATCATCATCTTCATCGTATGCCTCTTGGGCCTGTTGCTGCTGCTTCCTACGCAT
CTCCTCGTCAATGTTCACATCATGCAAGGTGGTTTCCTCGCACTCGTCCAATTCCATATCGGACGCTTGTGTTTTAGGCCTTGCTGGCAGCACTG
CTTCAAGATTCTTGCACAACTCTGGGGTTAATGTGTTGGGGAAGTCCACGGTGAAGTGAATGTACAGTTTCCCTTTCATGAATGGCCTTTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E433306] SGN-U286847 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T285443 [Download] [View] Facility Assigned ID: STMIV29TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5