Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E435180

Search information 
Request: 435180Match: SGN-E435180
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281467Clone name: STM-61-I19
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281467 [STM-61-I19] Trace: SGN-T287316 EST: SGN-E435179 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435180Length: 421 bp (842 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435180 [] (trimmed) TTTTTTTTTTTTCCTTTGAANAAGAAACATGGTTTTGCATTAAACTTAAGAATTGAATAAAGAAATGTAGTCTACTCATAGCTTGAATTTGACAG
CAAAACCGCAAAACCTAAACTTCCATGAAAACGTTCAAACGTTTTTTTTCTGTTTATGGAATTGAAAGGGGTAAAAGATAAAAGGAAGATCCCTA
ACTAAAGACGAGAAAAAAAATAAAAGACAAATAAGAATGTTCCATAGTAAACTAGTATTTTCCACCTCTGCTACTAGCCATTGAATTCCCTGGGG
ATCTAACTCTTTTTCATCACTCGTTGGGCTTGGCAAGGCCTAAGTTGGGGTTCAGCTTGAATGCACGCAAGTAAGGATCCATGGGTAGACCCATG
GCAGCATACCTTGGATCGTATGGCTCAAATGGAGGACTGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435180] SGN-U296600 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287317 [Download] [View] Facility Assigned ID: STMJG58TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0137 Quality Trim Threshold: 20.5