EST details — SGN-E435843

Search information 
Request: 435843Match: SGN-E435843
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281875Clone name: STM-62-K23
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281875 [STM-62-K23] Trace: SGN-T287979 EST: SGN-E435842 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E435843Length: 580 bp (866 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E435843 [] (trimmed) CGGGCCCCCCCTTTTTTTTCCAAATTGAAAAATCTTCTTATATTTGTCCATCAATAGTACATCATGACTTTTTCTTCTGTCTTGATCTCATGATC
AAGCAAAAAGCTATTGCTATTACAAGTAACATGATTAGTGCTAATTAGATCCTTAATCTCCTCCAAGCTACTATAATCTAATGGATTTTGTTGCT
CATCAACATGACAACCACTACCATTATTTCCACTAATCAACTTTTCTCCTTCACTAATACCACCATTGTTATTATACATATAGCTATGAAAATTA
AAATTCGAAATGTCATAACTCTCTTCAGAAGAGGTAGTAGGACCCACAAAAGTACTAGCGGTTATGCCTGAGGTACAACTAGTCGATGCACCCCC
AGCTTAAGAAACTTGTACTTGATGGGATTGTACTAGGAATATTGGTTTCATAGCATGGGAAAGTTGTGTTGTTGGGATAATTTGATGAGATTAAT
AAAGATGAAGCTTGAAGAAGTGAAATTTGTGAGGAATAATTATTGTAACAATTAGTGGGAATTTGGTGTTGATAATGATGATGATTAAGAGGCCT
AATGATCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E435843] SGN-U276527 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T287980 [Download] [View] Facility Assigned ID: STMJK72TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0038 Quality Trim Threshold: 20.5