EST details — SGN-E436164

Search information 
Request: 436164Match: SGN-E436164
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C281840Clone name: STM-62-J11
nocartOrdering Not Available
Library Name: STMOrganism: Solanum tuberosum

Tissue: mixed tissues
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C281840 [STM-62-J11] Trace: SGN-T288300 EST: SGN-E436163 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E436164Length: 505 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E436164 [] (trimmed) TGGGTACGGGCCCCCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAGAGTTGAAGAATTTTTTTTATAGTTTTCACAAATTAACTACTAGA
CATCCAAATTGTTTGTCCATATAAAATTTCAACTTCAAATCAACCTGATCTCAAATTACACACTTGAAATCATGTCCAAACGCGCACTAGGTTAA
GAGTCATTTTGTATGACATCAGTATGAACACCAAAAGCTTTGGAAGAATTGATAAAATCTTTGTAAAGAATGGATTTGTAAAGAGGTGGATTAAA
GTCATTCAATAGGACTTTTGCTGGCTCAACAATGCTGTTGGGAGTTGGATTCACAAATATGGCTATTGATGTTCTTGCTTCCTTTGAATTTGTTA
CTGCTCTATGCTCCACACTTCTTAGCTTCCCGTTACTGATTATCTCTAATTGATTGCCTATGTTGACAAGAAAGGCATTAGGCACAGCCTCAACA
CACATCCACTTTCCATCTACCAAAACTTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E436164] SGN-U294153 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T288301 [Download] [View] Facility Assigned ID: STMJM54TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0055 Quality Trim Threshold: 20.5