EST details — SGN-E43684

Search information 
Request: 43684Match: SGN-E43684
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28011Clone name: cLEF-46-E4
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176852 is on microarray TOM1: SGN-S1-1-7.1.8.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C28011 [cLEF-46-E4] Trace: SGN-T61541 EST: SGN-E247130 Direction: 5' Facility: TIGR
Clone: SGN-C176852 [TUS-25-A10] Trace: SGN-T181793 EST: SGN-E369301 Direction: 3' Facility: INRA
Clone: SGN-C176852 [TUS-25-A10] Trace: SGN-T181794 EST: SGN-E369302 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E43684Length: 596 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E43684 [] (called/trimmed by facility)
GAACTCTCAGCTATCTCCTTAAGTAAACCAAAATAGTTGATTTTGTTGAATTAATCGCAGATGGCAGGTGGGTATAGAGCTGAGGATGATTACGA
TTATCTGTTCAAGTTGGTGTTAATTGGAGATTCTGGTGTAGGAAAATCCAATCTCCTTTCTCGATTCTCAAGAAACGAGTTCAATCTTGAATCAA
AGTCTACTATTGGTGTTGAATTTGCTACCCGTAGCATTAAGGTAGATGATAAGATCGTTAAGGCTCAGATTTGGGATACTGCTGGACAAGAAAGG
TATCGTGCAATTACAAGTGCATACTACAGAGGGGCTGTCGGTGCATTAGTTGTCTACGATATCACTCGACATGTCACATTTGAAAATGTTGAGAG
ATGGTTAAAAGAACTTCGAGACCATACCGACCAAAATATAGTCATAATGCTCGTTGGGAACAAGGCCGACTTACGTCACTTGCGTGCTGTTTCAA
CAGAGGATGCCAAGGCCTTTGCTGAAAGAGAGAGTACCTTCTATATGGAGACTTCAGCACTTGAATCCTTGAACGTTGAGAATGCGTTTACAGAA
GTACTGACAGAGATATACAGGGTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T61541 [Download] [View] Facility Assigned ID: TMGGZ26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence