EST details — SGN-E43950

Search information 
Request: 43950Match: SGN-E43950
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61369Clone name: cLEM-17-H6
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C61369 [cLEM-17-H6] Trace: SGN-T85901 EST: SGN-E269759 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E43950Length: 452 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E43950 [] (called/trimmed by facility)
CCACCTGCATAACCCAGCTTCAAACACCTGTTAAGCTTATGCGGCCATCTTTGATTGTGTTAATAAAGGAAGGAGGCAATGGGATCAATGTTCAG
TTCACCTCAGTTTAGCAAAGAACAAATGGAGGCCGCTCTTACCAAAGCCAAGCAGATCGTTTCCTCTAATCCTGTTGTCGTATTCAGTAAAACAT
ACTGCGGATATTGCACAAGGGTGAAGAAACTTCTTTCCCAGCTTGGTGCTACTTTTAAAGTTATTGAACTTGACCGGGAAAGTGATGGAGATGAG
GTTCAAGCAGCATTACTAGAATGGACTAAGCAGAGGACTGTGCCTAACGTGTTTATTGGGGGAGAACATGTTGGTGGCTGCGACAGCGTATTAGA
GAAGCATCAACAGGGAAAGCTACTTCCCATGCTGAAGGACGCCGCTGCTATTCCCAACAATCCTGCCAAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T85901 [Download] [View] Facility Assigned ID: TGFCP39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence