Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E451152

Search information 
Request: 451152Match: SGN-E451152
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C238277Clone name: cSTS-11-L15
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E451152Length: 588 bp (950 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E451152 [] (trimmed) AAACTAAGGAATAATTACACTACTACATTCAAAAGATGATTTTTGTGTTCCACCTTGACAAAAAAAGAAAACATGAGGACACCTAAACAAACAAT
TATCAACTAAACTGACATTAGCAGAATCTTGTTTAAGAACAAGCAAAGGACGAGGTATCCCACCGAGCAAATAATTTCCTCCCAACAAAAGCCTC
CCAAACGGAGCCATCCCAATTTCAGGAAAAACCGTTTTCAATGCAAACTGAACCGGTATTAAACCGGTGAACCGGTTATTCTCCAAAGACAAAGA
AGAAAGCTTTGGCATCGTAGCTAAAAACGCAGGTAAAAAACCTTCAAGCTGGTTATTACTCAAATCAACCGCTATAAGCTCGCTTTGAGATGATT
CTGTTCCATAAGAAGGAGCTTCAATGGAGGAAAATTCGTTGAATGAAAGTGTTAACTGTTGCAAAGATGGAAGCTGAAAGAATATAGAAGGAACA
TAGCCATTGATTTTGTTTGAACTGAAATCCACAACCTGCAGATAATTCAAATTCTTGAAGCTTTCAGAAGCTAAACTACCACTTAAATTATTGTT
CCTCATTGAAATCTGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E451152] SGN-U295500 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T236728 [Download] [View] Facility Assigned ID: PEYBQ68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0018 Quality Trim Threshold: 20.5