EST details — SGN-E451156

Search information 
Request: 451156Match: SGN-E451156
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C238281Clone name: cSTS-11-L23
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E451156Length: 699 bp (948 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E451156 [] (trimmed) TCTTCAGAAATGGCCGCATTCTTAGCTCGGAAATCTCTTCTTGCTCTTCGTACCCGCCAGCTTGCTGTCGCAGGTCAAGGGCTGCACAACACTCA
AAATTATGGCATGCGATTGAGTTCACACCTCTACTCTACCAAATTAGAGGACGAAGAAAGGGAGAAACTTGCAAAGGAAATTTCAAAGGATTGGA
GTACAGTTTTTGAACGTAGCATCAACACACTTTTTCTCACTGAGCTTGTTCGAGGTCTAATGCTGACGCTGAAATACTTCTTCGATAAAAATGTT
ACCATCAATTATCCATTTGAGAAAGGCCCATTGAGTCCTCGTTTCCGTGGTGAACATGCACTCAGAAGATATCCAACAGGAGAGGAACGCTGCAT
TGCTTGCAAACTTTGTGAAGCTATATGTCCTGCTCAAGCAATAACAATCGAGGCTGAGGAGCGTGAAGATGGCAGCCGTAGGACAACTCGGTATG
ATATTGACATGACCAAGTGCATCTATTGTGGATTTTGTCAAGAGGCATGCCCAGTTGATGCCATTGTTGAAGGGCCAAACTTTGAATTTTCTACA
GAGACTCATGAGGAGCTTTTATACGACAAAGAGAAGCTGCTTGAAAATGGTGATAGATGGGAAACTGAAATTGCAGAGAACCTGAGATCTGAAAG
CCTTTATCGCTGATAATCTCGTTGGAACCCTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E451156] SGN-U298510 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T236732 [Download] [View] Facility Assigned ID: PEYBQ72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0025 Quality Trim Threshold: 20.5