EST details — SGN-E45515

Search information 
Request: 45515Match: SGN-E45515
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C115616Clone name: cTOA-27-K16
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C115616 [cTOA-27-K16] Trace: SGN-T129171 EST: SGN-E317067 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E45515Length: 766 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E45515 [] (called/trimmed by facility)
GCACGAGGGTTTGTTCTCATTTGTCAACGAGATATGATTATATGAAAGATCAAGATAGTAAAGCTGTTTGAGGTCAGCAAAGAGGCTGACATCCA
CATGGCCACTAAAATTATTGAAAGAAAGAATAAGGCCTGTTAGGTTCACATGGTTTTGAATCAACTTGGGAAGAGGTCCTTGCAGCTGATTATTG
CTTAAATCAATCCAGATCAGTGAATTTGAATTGAAATCCTCAAACTGACCAGAAAACTGGTTATTGCTTAAGACTAAACGACTTAGTGACGGAAG
AGAGAACATCCCTGATGGTATTGTTCCATTCAGGGAGTTATATTGAAGGTCCAAATCCTCTATGCGCGTGAGATTCAAAAGAGATTCAGGAATAG
GCCCTCTAAGTTTGCAATTTTTAAGAGACAAAGAATGCACCGAAGTTAGATAGCCAATAGACTCAGGCAAATTATCAGAAAAATTCACGCCACTG
AGGTCTAACTCGATGAGAGATGCACTACTGTTCCATTTAGTCTTCGGAAAATAACCAGTGAGCTGATTGTTGTTTTGTAAGACAAGTGTTTCCAG
ATTGGGAAGGTGAAAAATACTCTCAGGTATTATCCCGTACAATCCTGTATTTCCCATCCTCAGAGTTGTCAAATGAGAAGAAAATTTGGAGGAAT
GGTGGAAGAGATGTTTATGGAAGTAAGATCAAGCTCTCTTAATTGAGTCAAATTCTGAAGGAGCAATGTCAAATCATGGGGCTGTGAGTCTTAGA
ATAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T129171 [Download] [View] Facility Assigned ID: TFAEB68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence