EST details — SGN-E45977

Search information 
Request: 45977Match: SGN-E45977
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10377Clone name: cLEC-68-N3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10377 [cLEC-68-N3] Trace: SGN-T34171 EST: SGN-E210822 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E45977Length: 785 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E45977 [] (called/trimmed by facility)
ATTTAAAGTTTATTCTCTTGTCAATTAAATTTGTTGGCCTGGCTACATGTTTCCAGCAGGATTTGAATAGTCATGAGTCAACAAGAGCCTTCGAA
AAGATACAAAAGAGCAAAAAAGAACCTTGCTTTACGTGGATCATTATCATTCTGGGCAAATAAAAAACAACGATTATTGACAACAAATGAAATAT
TTCAAGCTATAGAGTGAGGAAACGACATTTTCTAAACTTAATTGAAGAACAACATCAAGGCGTAGCACCAAAATCTCAAGCAAATGAATAATCTG
AAGAAATTAGGCAATCTTTAGAGGAACAACCTCCAGATGAGCAGCCCCTAGAAGAGCAAGTGGAAATTAATTCTATCATTCCTCCAACAAATGAA
CAATCTGAATAAATACTAAGAATCGAAAAAAGCAGATGAACCCACACACCGCTGGCAAAAAGAGTTTTGCTTTAGTCCGTAACAAATTGGAAAAA
GAAAAGGAAACTGTATCAGCTAAAGAGATCTTTGTGTTCACAAGAACAAGGAAACTTGGGCATTTGTACAAGACCTCGACGAAAACACAACTAGT
AAAATTCCGTTATGGGTCATGAACATCCGGTACGTCTCATACTGTATGGGAGTGGGGGTTACAAAGACTGCATTGAAAATAAAACCTGGAAATTC
TGACCATTCTTTAAAGGCCACAGATGATGTAGTTCACAAATGCAAAATAACGGAGAAACGGATGGAGGAACAAATAAACTATGCGACAACAGCTA
TCACAAAGTAATGCACACTTCAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T34171 [Download] [View] Facility Assigned ID: TCAKK74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence