EST details — SGN-E46207

Search information 
Request: 46207Match: SGN-E46207
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C10778Clone name: cLEC-6-E10
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183871 is on microarray TOM1: SGN-S1-1-4.1.18.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10778 [cLEC-6-E10] Trace: SGN-T23953 EST: SGN-E202292 Direction: 5' Facility: TIGR
Clone: SGN-C183871 [TUS-43-E21] Trace: SGN-T1785 EST: SGN-E378622 Direction: 5' Facility: Giov. Lab
Clone: SGN-C183871 [TUS-43-E21] Trace: SGN-T196227 EST: SGN-E394901 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E46207Length: 679 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E46207 [] (called/trimmed by facility)
GTTGTCTTTGCAAAACCAGCAAGGTGAGACTGCATTATATATTGCTGCAGAAAATGGACATACTTTAGTTGTTGTAGAGATTTTGAAACATTTGG
ACCTTCAAGTTGCTTCTCTTGTTGCAAATAATGGATATGATGCATTCCAAGTTGCAGCAAAGCAAGGTCATCTTGAAGTACTGAAGGAACTATTG
CATTCGTTTCCAAACTTGGTTATGGCTACAGATTCATCCAATTCTACAGCCTTACATACAGCAGCTGCCCAGGGTCATGTTGATGTCGTAAATCT
GCTTCTGGAGATTGATTCGAACCTTGTTAAGATAGCTCGGAACAATGGGAAAACTGTGCTCCATACAGCAGCAAGAATGGGACACTTGGAAATTG
TTAAGTCCCTTCTGAGCAAAGATCCTGACATTGGCTTTAGAACGGATAGTAAAGGCCAAAGTGCCCTGCACATGGCTGTAAAAGGACAAAATGTT
GGCATTGTGCTCGAGTTAATAAAACCGAATTCTTCTGTATTGACCTTGGAAGATAACAAAGGAAATAGAGCTCTTCATATTGCAACAAAAAAAGG
ACGGCCACAGATGGTACAATGTCTTATATCAATTGAATGCATCGATCTGAATGCCATTAATAAGGCTGGAGAAACAGCTCTTGATATTGCTGAAA
AGTTTGGAATGCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T23953 [Download] [View] Facility Assigned ID: TCAAV29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence