EST details — SGN-E467702

Search information 
Request: 467702Match: SGN-E467702
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C216747Clone name: cSTB-1-F9
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C216747 [cSTB-1-F9] Trace: SGN-T212922 EST: SGN-E467701 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467702Length: 497 bp (862 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E467702 [] (trimmed) TTTTTTTTTTTTTTTTTTTTGGAACAAACTACAACAATTACATTCCAAAAGTAAAAAAAGTTGGTTTAAGGTTCCATTTGACACAGATCAAATTG
CCCAGCACAAAACTTCATCATCAGAGGGATCTGATGTGCTCCATATATGGCATCATCAAGATTTAGAAAGCAAGAAAGTGGGGCAATCGATCGAA
TATGTGTTAAAAAACAATCATAGAATCAAAATGAACAAGAATTGAATGATCCTACCGCACAATTCAAAGAATGTATCACTGGGCACTCTTCTTTC
CATTACCATAGTAATTGAGGTACCATCGAACAAATTTCTTCAATCCCGTCTGTAGATCCGTCGTAGGCTTATATCCAAGCTCCTTGTGGGCTGAA
CTTATATTGGCATGAGTAAATGGCACATCTCCATTCCTTGGCAACTTCATCACCAATCTCTTGGCCTTAACCTTTAGCAACCTCTCCAAAATGCT
GACAAGATCTGAAACTGGCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467702] SGN-U295994 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T212923 [Download] [View] Facility Assigned ID: PSHAC29TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5