EST details — SGN-E469467

Search information 
Request: 469467Match: SGN-E469467
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C217297Clone name: cSTB-11-H20
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E469467Length: 588 bp (969 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E469467 [] (trimmed) CCTCGTGCCGTACAAACAACAATCAACACACTCCCTCTTCAAGCCTTTCTATATAGGGTCTTGAAGAGCCAAAATCAATATCTGACTAGTCTTTC
TGTTTTCTAACAAAATAGAATTTGTCTATAAATGGGTAAAGTCTTCAATTTAGCTGAGGTCTCCCAGCACAACAATGCCAAGGATTGTTGGCTCA
TTATTAGTGGCAAGGTGTATGATGTGACAAAATTCTTGGAAGATCACCCGGGTGGTGATGATGTTTTATTGTCTGCAACAGGTAAGTAAAATAGT
AGGACGTATTCTTCTTGCGGAAGAACATCACTATATTTTGTATTCAATTTCTTGTAATCTTACATATGCACCAATTTTTGTTTGTGTTAAATTCA
CTCGAACATCACTGAAATCCAGATGAGCCATCTCTGAAATGCTAGACAACTTAAATATGAAAAACTATGTAATTTTGTAGCAGACACTGGTTTAT
GAGACCCTGATACATTGTCACATTAAAGTACTTGAATTTTACCCACTCTGTATTTTTGTATTCAATTTTTAGTAATCTTAAATATGCACACCAAT
GTGTGTGTGTGTGTGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E469467] SGN-U289049 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T214688 [Download] [View] Facility Assigned ID: PSHBR46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5