EST details — SGN-E47032

Search information 
Request: 47032Match: SGN-E47032
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C11010Clone name: cLEC-6-O16
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172828 is on microarray TOM1: SGN-S1-1-7.1.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11010 [cLEC-6-O16] Trace: SGN-T23980 EST: SGN-E202319 Direction: 5' Facility: TIGR
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T195241 EST: SGN-E393915 Direction: 3' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T195391 EST: SGN-E394065 Direction: 3' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T195391 EST: SGN-E399069 Direction: 3' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T199601 EST: SGN-E398275 Direction: 5' Facility: INRA
Clone: SGN-C172828 [TUS-14-I18] Trace: SGN-T200215 EST: SGN-E399070 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E47032Length: 635 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E47032 [] (called/trimmed by facility)
GCTATCTCTTTTCTCTATATATGGCTTTTGAATTCATGAAAATCACGTTCTCAAGCTCACGTCAACTTCGAAAATTCTTTATATCACTATAATCC
ACAACCAAAGACTTTTAAGCCTCATATAATCACAACCACAACCTATCTTGTATGAGATAAATTTCAAGTGCTATAAATATACCTAACGAAAAGTT
ATAGTTAGCAGTACTGAAAAAAACGAGATAAACATGAGTAATTGTTTGCAAAGCTGGCCGGAGCCAATTGTCCGAGTTCAAGGACTCTCGGAAAG
TGGCATTCGAGAAATCCCTGACCGGTACGTGAAACGACCATCGGATCGTCCATGTTTCAAGGAGACAACAACGTTGTCGTCATCATCACACCTTG
AGAATATTCCGTTAATTGACCTTGAAAACTTGAATTCATCGGATGAATCCATTCGCGATGAGACAATGGAACTCATTTCCAAGGCTTGTCGCGAA
TGGGGTTTCTTCCAAGTGGTGAACCACGGCGTTAGCCATGAACTTATGGCTAACGCACGTAGCGTCTGGCGGGAGTTCTTTCATCTCCCGCCAGA
GGAAAAACAAAAGTTTGCGAATTCACCCGTTACTTATGAAGGATATGGAAGTAGACTTGGAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T23980 [Download] [View] Facility Assigned ID: TCAAV92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence