EST details — SGN-E47036

Search information 
Request: 47036Match: SGN-E47036
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34201Clone name: cLEG-30-B3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177155 is on microarray TOM1: SGN-S1-1-8.2.8.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C34201 [cLEG-30-B3] Trace: SGN-T69084 EST: SGN-E255358 Direction: 5' Facility: TIGR
Clone: SGN-C177155 [TUS-25-N1] Trace: SGN-T181926 EST: SGN-E368973 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E47036Length: 350 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E47036 [] (called/trimmed by facility)
GGTTCGTTACAGCATCAACCATGGTTCTCAAGACAGAACTTTGCCGTTTCAGTGGTGCCAAGATTTACCCTGGGAGAGGCATCAGATTTATCCGG
TCAGACTCTCAGGTGTTCCTATTCGTCAACTCAAAATGTAAACACTACTTCCACAACAAGTTGAAGCCATCCAAGCTTACATGGACAGCTATGTG
TAGGAAGCAACACAAGAAGGATATTGCACAAGAAGCTGCTAAGAAGAGGCGACGTACCACCAAGAAGCCTTACTCTAGGTCTATTGTGGGTGCAA
CCTTGGAGGTAATCCAGAAGAAGAGAACTGAAAGGCCAGAAGTTCGAGATGCTGCCAGGGAGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T69084 [Download] [View] Facility Assigned ID: TBFEO02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence