EST details — SGN-E477881

Search information 
Request: 477881Match: SGN-E477881
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C229820Clone name: cSTD-2-G15
nocartOrdering Not Available
Library Name: cSTDOrganism: Solanum tuberosum

Tissue: dormant tuber
Development Stage: one month post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E477881Length: 594 bp (959 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E477881 [] (trimmed) GGCATCTTTCCATACCCAAAGAAAAAGTCGTTCCTATTGTGGATCAACTTGATTTTTGTCTCCTCCACAGGGATGTAGATCCTATATCTTTCTCA
AAAAGTTTGCTGGTAGCACTTGAAGAGCTGTCAAAGCGTTTGCTTCAGCTGAATGACATTCCACTAAAGGTGTCGACTGTGCAAGCTCTAGACTC
AGCTGCTAGGTTGACATCTGTCTTTCCGCCCATGCCTCATCCTCTGGCACATGAGAAGAGTGTTGGCATAAAACTAAGGAAGCCCGTTTCAACCT
GTATAAATCCAGTTGAAGTTATGATTCAGCTTGAAGGGTCTGGAAGTTGGCCAATGGATGAAATTGCAATAGAGAAGACAAAAACTGCATTTCTT
CTTAGAATTGCTGAGAGTCTGCAGAACAATTGGGGGATGATGTTTACAGCTACAGAAGATGATGTAGATGTTCTAATGTCTGGCTATGCATTCCG
CCTTAAAATTTCTCATGAAAGGGCTCTTGGTTTGGTGACTGGGCAAAGTAATAACAGTCGACATCAATGGAGCCTCTCTGCTGACAGAAAACTTC
TTCTGCAACACCAACATGCGAGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E477881] SGN-U298912 Solanum tuberosum Build 4 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T223102 [Download] [View] Facility Assigned ID: PTDAE44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5