EST details — SGN-E47882

Search information 
Request: 47882Match: SGN-E47882
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C85030Clone name: cLET-37-E10
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C85030 [cLET-37-E10] Trace: SGN-T109810 EST: SGN-E293838 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E47882Length: 161 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E47882 [] (called/trimmed by facility)
CAGGTTTCTCTCTCAATAGATCCCTCATTCTAAAAGCTCTTTTCAGGGATCATCATCAAGGAAGCGTGATGGGGCTCACATTCACCAAGCTCTTC
AGTCGGCTTTTCGCCAAGAAGGAAATGCGCATTCTAATGGTTGGTCTTGATGCAGCTGGTAAGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T109810 [Download] [View] Facility Assigned ID: TMEFP29TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence