EST details — SGN-E489388

Search information 
Request: 489388Match: SGN-E489388
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C283361Clone name: KS01015D05
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E489388Length: 488 bp (740 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E489388 [] (trimmed) TTTTTTTTAACAAGCAATAAACTTCAATTTTTTTTTACTGAAAAAGAAAAGAAACGAATTCAAATCGATACATGATAAATAAAAAGAGAGGCCTT
CAGTTTGTTGATCATCTATGGAATAAGCATTGTTACTAGCATTCAAAAAAGGTTAAAGTAGAGTATAAAGAATGAAATCAGTGCTATCAGTTCCC
TTCTTAGAAACAACTCCACCAAATCTAACACCTGTCACATTTTCACTGCCGGAGACGCCACCAATCTGATTGCTGTTTCCTCCTCCGCCGCCGCC
GCCGCCGCCGATTTTGATATCAGCATTGGGAATCCTGTCGGAAAGCTTGCTGGGCGAATTGTAATTGGATTGTATGGTGATGATGTGCCCCAGAC
AGCAGAAAATTTCCGTGCACTCTGCACAGGTGAAAAGGGCTTTGGCTTCAAGGATTCTGCATTTCATCGTGTTATTAAAGATTTCATGATTCAAG
GGGGTGATTTCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E489388] SGN-U199132 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T290065 [Download] [View] Facility Assigned ID: KS01015D05
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5