EST details — SGN-E491934

Search information 
Request: 491934Match: SGN-E491934
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C284570Clone name: KS01032B01
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E491934Length: 309 bp (707 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E491934 [] (trimmed) ATGCGTTTTTTTTAAAAAAACACGCTCTTTTAAATTAAAGCGTTCAATATTTTTGGACGCCACTTCTAAAGCTTTTAATGAAACATCGCTCGCAT
GAATGGAAATTTTGGGGTTTTCTAAAGCCAAACTAACAGACACGCAAGCGCTCCCTATGCCTATTTCGCCTATCTCTTTTAAATGGTATTGAGAA
ATAATATCAAGGGCTTTTTTGACCAAAATCTCCGTTTCAGGCCGTGGGATTAAAACATGCTCATTCACGAAAAAAGAGCGCCCATCAAAATCACA
GCTTTCTAATAAATACTCTATGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E491934] SGN-U203735 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T291274 [Download] [View] Facility Assigned ID: KS01032B01
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0048 Quality Trim Threshold: 20.5