EST details — SGN-E492114

Search information 
Request: 492114Match: SGN-E492114
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C284750Clone name: KS01034A01
nocartOrdering Not Available
Library Name: KS01Organism: Capsicum annuum

Tissue: leave
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E492114Length: 568 bp (650 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E492114 [] (trimmed) AAAATGGTGCACAGTGCATACGATTATTCAACTGATCACAATTCCCCAAACAAAATCGACGCAATCGAATATACGGTTAAACTTACTCATCTACA
TTCCGACGGATCACTCCGCGTCTACGTTCCAGAATCATCGTCAACGTCCGNCAATCTCCACCGTCCGATATCACCCACAAAGGGGGGCTTTTACA
AGAGAGATATGTACTTGAAAGAACTGTTAATGGGTTTTCTAGAAGACAAATGCTGGCTATGGAAGTGCTTTTATCAAGAGAGCTATTGCTTTCGC
TTTCCGAATCGATTGCGTTTCATCGCTTGCCGAATTTGGAGACTTTAGCTGTGATTACCAAGGCCAAAGGAGCCAATGTGTATTCATGGGATGAT
AAAAGAGGGGTTTTGGCATTTGGGAGACAGAGAAGGGTTTGTATCTTTAGACATGATGGATAATATTGGTGTCTTAGTTGACCAAAACGGAAAGT
TGATTCAAGATGGGAGGGTTTGTTGGTCAGAGGCTCCTGCAGTTGTTGTTATTCAGAAGCCCTACGCTATAGGTCTCTTACCACGACATGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E492114] SGN-U204672 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T291454 [Download] [View] Facility Assigned ID: KS01034A01
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0113 Quality Trim Threshold: 20.5