EST details — SGN-E498268

Search information 
Request: 498268Match: SGN-E498268
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C292399Clone name: KS07057F03
nocartOrdering Not Available
Library Name: KS07Organism: Capsicum annuum

Tissue: Flower bud
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E498268Length: 196 bp (868 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E498268 [] (trimmed) CGGTCCGGCTCATGCGTCTCCGACTGCGGGAGCTGTTTCACAGCAGGTTGGGAACGCGGATTTTCTGTTTGGTTCGGAGAAGGGGATGGTACCTC
CACATGTGAAACTGAGAGATCCGAGTGCTGAGCAAGCTGCTAAGGAACCGGACATTCCGGTTCATGGAGTGGATGATCGGCTGATGGGGACTGAT
CCGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E498268] SGN-U204355 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T299103 [Download][View] Facility Assigned ID: KS07057F03
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0114 Quality Trim Threshold: 14.5