EST details — SGN-E50492

Search information 
Request: 50492Match: SGN-E50492
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C107833Clone name: cLPP-6-P13
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C107833 [cLPP-6-P13] Trace: SGN-T175199 EST: SGN-E361427 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E50492Length: 403 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E50492 [] (called/trimmed by facility)
GATAATAATTTGTCTAACTCAACAAGGCCTAAAGGATATTTGATTTGATTAATTTTGTTAATCAAAAGGCAAAAACAATGGGAGCATGTGCAAGC
AAGCCTAAGGTCTTGGAGGGTACCGCTCCTCATGTGTTGGGAGAAGACATCATGAACAACAACAAGCAAGAAGGAATTGTGGGCGATGATGTTCC
TAATAAGCCTCACTCTCTCAGTAATTTGTTCAAGGAGGGAAAAGAAGGGTCAGAAGAAGTGAAAGAGGAGACATCCACAGAAGCACAGCTACCAA
AGACGGAGGAGACCCCAGAAAATAAAACAGAGGATGTTATAGAATCAGAAAAAGAAGCAGAGGAAGTTATAAAATCAGAAAAAGAAGAGACAACT
ACTGAGGCACAGAATGAAGAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T175199 [Download] [View] Facility Assigned ID: TPOAW91TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence