Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E507498

Search information 
Request: 507498Match: SGN-E507498
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C301963Clone name: KS11011B05
nocartOrdering Not Available
Library Name: KS11Organism: Capsicum annuum

Tissue: Early root
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E507498Length: 389 bp (1208 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E507498 [] (trimmed) AGAAAATGATATGAAGCCGGATGTTGTTACTTACACCACTCTCATGAAAACCTTGATACGTGTGGAGAAATTCGAAAGGGTTCCAGCTGTTTATG
AAGAAATGGTATTGTCTGGATGCATCCCAGATAGGAAAGCTAGAGCGATGCTACGATCTGCTCTGAGATACATGAAGTCTACATTGAAGTTGTAG
CAGACTGCAAGTCACTCTAACAAATATGACCATGCTGAGTCATGATTTTTCAGTATAACTTTCAATTTAAGCTGTTGTTCCACTCTTGTGCATTA
ACCTTTGTCACAATTCAAGAACTTCATGTTTGACAGCCAAATTGGGAAGGTTAATAAAAGATCCTAGGTCCTTTGTGTCCCAGCATACTTTCATC
TACATACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E507498] SGN-U204830 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T308667 [Download][View] Facility Assigned ID: KS11011B05
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5