EST details — SGN-E509939

Search information 
Request: 509939Match: SGN-E509939
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C305941Clone name: KS12035C10
nocartOrdering Not Available
Library Name: KS12Organism: Capsicum annuum

Tissue: Placenta
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E509939Length: 375 bp (918 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E509939 [] (trimmed) CTTGGCTAAGCAGGCAGGTGTTCCCGATGGAGTGATCAATGTCGTAACAGGATTTGGATCTACTGCTGGTGCTGCACTTTGCTCGCATATGCACG
TAGACAAGATAAGCTTCACAGGCTCGACAGAAGTTGGACGACTAGTAATGCAGGCTGCAGCGTTAAGCAATTTAAAACCTGTCTCGCTAGAGCTG
GGAGGGAAGTCGCCTTTTATAGTATTCGATGATGTACATGTTGACAAAGTTGCACCACTTGCTCTTATCGGAATCCTATACAACAAGGGAGAAAT
TTGCGTGGCTGGATCTCGCCTTTTCATCCAAGAAGGAATTTACGATAAATTTGTCAAGAAATTGGAAGCGATGGCAAAAACATGGGTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E509939] SGN-U201092 Capsicum annuum Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T312645 [Download][View] Facility Assigned ID: KS12035C10
Submitter: Kribb Sequencing Facility: KRIBB
Funding Organization: Ministry of Science and Technology (Korea)
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0169 Quality Trim Threshold: 14.5