EST details — SGN-E513979

Search information 
Request: 513979Match: SGN-E513979
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308075Clone name: cSML-10-E15
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308075 [cSML-10-E15] Trace: SGN-T314853 EST: SGN-E513980 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E513979Length: 585 bp (1061 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E513979 [] (trimmed) GTGGATCCAAGGTCTACCTTCCTTACATTCTCTAAACCCTTCACTTCTCACTCCTTAAATCTTCCTTCTTTCTCTACCCAAAGACCCATTGGTCT
GAAGAGAAATTCTTTGAGAATTAATGCCGTTGCCCAGAAATGGGAACCCACAAAGGTTGTGCCTCAAGCTGATAGAGTTTTGATTCGGTTAGAGG
AGTTGCCTGAGAAATCTGCTGGTGGAGTTTTGCTTCCAAAATCAGCAGTGAAATTCGAGCGCTATCTGGTGGGAGAAGTTCTTTCTGTTGGTTCC
GACGTTGCTCAAGTAGCGGCGGGGAAGAAGGTTCTTTTCTCTGACATCAATGCATACGAGGTGGATTTGGGAACTGATGGAAGGCATTGTTTCTG
CAAGGAGAGTGAGTTGCTGGCTTTGGTTGAATGAGAAGTCTCTCATTTCCATTATAATTATGTCTAAGTTTTGTCAGGTTCTTAGCCATAAGACT
TTGAAACCGCGGGATGTATTGTAAAATCTCATCTTTTGTAGAACAAAAATGTTGAGATATGTTTAGTGGATATTTTTCTGATTTACAGGCAAAAA
AAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E513979] SGN-U206087 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T314852 [Download] [View] Facility Assigned ID: cC-smflcSML10E15c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5