EST details — SGN-E513980

Search information 
Request: 513980Match: SGN-E513980
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308075Clone name: cSML-10-E15
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308075 [cSML-10-E15] Trace: SGN-T314852 EST: SGN-E513979 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E513980Length: 315 bp (837 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E513980 [] (trimmed) TTTTTTTTTTTTTTTTTTTTGCCTGTAAATCAGAAAAATATCCACTAAACATATCTCAACATTTTTGTTCTACAAAAGATGAGATTTTACAATAC
ATCCCGCGGTTTCAAAGTCTTATGGCTAAGAACCTGACAAAACTTAGACATAATTATAATGGAAATGAGAGACTTCTCATTCAACCAAAGCCAGC
AACTCACTCTCCTTGCAGAAACAATGCCTTCCATCAGTTCCCAAATCCACCTCGTATGCATTGATGTCAGAGAAAAGAACCTTCTTCCCCGCCGC
TACTTGAGCAACGTCGGAACCAACAGAAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E513980] SGN-U206087 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T314853 [Download] [View] Facility Assigned ID: cC-smflcSML10E15d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5