EST details — SGN-E514048

Search information 
Request: 514048Match: SGN-E514048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308109Clone name: cSML-10-G11
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308109 [cSML-10-G11] Trace: SGN-T314920 EST: SGN-E514047 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E514048Length: 170 bp (889 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E514048 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTACTTTTTAATGCGTGACGCCCAGGCAGACGTGCCCTCGGCCTGACGGCTTCGGGCGCAACTTGCGTTCAAAG
ACTCGATGGTTCACGGGATTCTGCAATTCACACCAAGTATCGCATTTCGCTACGTTCTTCATCGATGCGAGAGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E514048] SGN-U206952 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T314921 [Download] [View] Facility Assigned ID: cC-smflcSML10G11d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0123 Quality Trim Threshold: 14.5