EST details — SGN-E517500

Search information 
Request: 517500Match: SGN-E517500
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310038Clone name: cSML-16-D7
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310038 [cSML-16-D7] Trace: SGN-T318374 EST: SGN-E517501 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517500Length: 315 bp (930 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517500 [] (trimmed) TCTATCAAGATGGGTAAAGAGAAGACTTACATCAGCATTGCGGTCATTGGCCATGTCGACTCTGGAAAGTCGACTACTACTGGTCACTTGATCTA
TAAGCTTGGCGGTATTGACAAGCGTGTTATTGAGAGGATCGAGAAGGAAGCTGCTGAGATGAATAAGAGGTCATTCAAGTATGCCTGGGTGCTTG
ACAAGCTTAAGGCTGAACGTGAGCGTGGTATTACCATTGACATTGCTTTGAGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCC
CCCGGACACAGGGACTTTATCAAGAACATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517500] SGN-U205817 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318373 [Download] [View] Facility Assigned ID: cC-smflcSML16D7c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0192 Quality Trim Threshold: 20.5