EST details — SGN-E517501

Search information 
Request: 517501Match: SGN-E517501
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310038Clone name: cSML-16-D7
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310038 [cSML-16-D7] Trace: SGN-T318373 EST: SGN-E517500 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517501Length: 257 bp (1058 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E517501 [] (trimmed) CACACCAAGGCACCTCAACAGAAGCAAATCAAAAGAGACTCAAAATCATGCTCGCCACCGCCTGTCAAGTACCCAGTTCTGAGAATGGTTACTTG
ACATAAAAGGCAGAGAACTAGAACCTAATGAGCAAATCAAAGACCAAACTAAAGCAGAACTAAATAAAACAGAGTCTAGATAGCACACTTGATGA
TAATAGATAGCATTGGAAACACCAGCATAACACTGTACCGTTCACTTTCCCTTCTTCTGGGCAGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517501] SGN-U205686 Solanum melongena Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318374 [Download] [View] Facility Assigned ID: cC-smflcSML16D7d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0061 Quality Trim Threshold: 20.5