EST details — SGN-E517744

Search information 
Request: 517744Match: SGN-E517744
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310164Clone name: cSML-3-D05
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310164 [cSML-3-D05] Trace: SGN-T318616 EST: SGN-E517743 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517744Length: 337 bp (644 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E517744 [] (trimmed) TTTTTTTTTTTTTTTTTTAACAAGAACGTCATAATATTATTTCAGAGATTTACCAAGCAAACACCGAACACGCTGTGCTACCAGCAACAGCAGAG
TAATACTAGCAACTTCATTTGGAACTGGAAGTCCATTAGCTCATAAGCTTGCTAGGAAAACCTAATTTACAACATAGTAGTAAGTATTACTGCTT
AATAACTTAATACCCAACGTAAAAAACATATAATTACAAAGAAAGATCGGAAGTCCAGTAATCCATGCTTTCACTCAGCAGAGAAAAAAACACTA
TCTACACCATGGTTTCAACTGCTTTTGCCAACCAAAAACTCTTACAACTTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517744] SGN-U205744 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318617 [Download] [View] Facility Assigned ID: cC-smflcSML3D05c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0222 Quality Trim Threshold: 14.5