EST details — SGN-E517979

Search information 
Request: 517979Match: SGN-E517979
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310280Clone name: cSML-3-J13
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310280 [cSML-3-J13] Trace: SGN-T318851 EST: SGN-E517978 Direction: 3' Facility: Cereon
Clone: SGN-C310280 [cSML-3-J13] Trace: SGN-T318853 EST: SGN-E517980 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517979Length: 208 bp (624 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517979 [] (trimmed) GAGAGCGTGTAAGACTCTATACCAGAGGAACAGTTCTTGGATACAAGAGGTCGAAGTCCAATCAGTATCCGAATACTTCATTGGTTCAGATCGAG
GGAGTCAACACTAAGGAGGAAGTAGATTGGTACTTAGGGAAACGTTTGGCTTATATATACAAGGCGAAAACAAAGAAGAATAACTCACATTATCG
TTGCATTTGGGGGAAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517979] SGN-U206304 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318852 [Download] [View] Facility Assigned ID: cC-smflcSML3J13b1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0092 Quality Trim Threshold: 20.5