EST details — SGN-E517980

Search information 
Request: 517980Match: SGN-E517980
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310280Clone name: cSML-3-J13
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310280 [cSML-3-J13] Trace: SGN-T318851 EST: SGN-E517978 Direction: 3' Facility: Cereon
Clone: SGN-C310280 [cSML-3-J13] Trace: SGN-T318852 EST: SGN-E517979 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E517980Length: 406 bp (648 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E517980 [] (trimmed) TTTTTTTTTTTTTTTTTTAAATTCAAATTATTTAAGACCACCTTTTTGTTACACTGTGAAATGTGATCATATTAATACACATAAACGATCCGAAG
GCCGAACACATTCGCAAATCACAAAAAGGAAAATAAACTGATACACAGATAGATAGATCTAAAGCACAAAATGCCATAGATGAAAGGTCAGATAT
AGATAGGAAATCGATCAGATCAGACCAGATTAGATCTAATCACTGTCGCTGCTGCTGCTGCTATGTCCATCATGTTTCTTCTCCTTTTTGTCTTT
CTTCTTCTTCTTCTCCTTCTTATCCTTTCCATCCTTGTGATGCTCTCCACTATCTTCTTCATGGATCTTATCTTTCACCTTGTCCATAAATCCTT
CCTTGTGCCCTTCTCCCTTATGATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E517980] SGN-U205625 Solanum melongena Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318853 [Download] [View] Facility Assigned ID: cC-smflcSML3J13c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0062 Quality Trim Threshold: 12.5