EST details — SGN-E518754

Search information 
Request: 518754Match: SGN-E518754
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310738Clone name: cSML-6-C23
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518754Length: 353 bp (562 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E518754 [] (trimmed) AGAAAATCCAAGAGAATTTGGGGAGGGCCTTTGAAAACAAGAAATACCCAAGCTGGGTATTGCTCAAATATCCAAGATTTGGCAAGTGTAATGCC
CCATATGATGCACATTGACAATATCCCATCAACCCCAGGGAAGTTCAAGATGGAAAAGTCTCCTTACAATAGGCTAAGGATGCATTTTTCTCTAG
CCAAGCTCACATTTTGGTCATTTGTATTCTTGGGGTTGATCTTTGTGTTCTTCTACAGATCTCCAGCTTCTTCATCCCCTGTTTCTTCAGATCTC
TCAAGAAGATCTCTCAGAACCAGCTCCTATGGTGGTCCAGCTTGGGAAAAGAGGATTAGAGCTTCAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518754] SGN-U207304 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319627 [Download] [View] Facility Assigned ID: cC-smflcSML6C23c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0072 Quality Trim Threshold: 20.5