EST details — SGN-E519196

Search information 
Request: 519196Match: SGN-E519196
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311144Clone name: cSML-7-H10
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C311144 [cSML-7-H10] Trace: SGN-T320070 EST: SGN-E519197 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E519196Length: 284 bp (640 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E519196 [] (trimmed) CTACATGAGGAAGACAGCTCGCAGGCTAAGCCTGCTCCTCTGGTAGCCCATGGACGGTCCTGACCGTGTAAGACTTGGGCCCATTCTCTGGTAAC
CACCAAGCTACCTGACGGTGAGTTCCCTGGGACTACGGATGGGACACCGCCGGACTTTCAGCTGATCCTGAAACATTCGCCAAGAACCGTGAATT
GGAGGTGATCCACTGCAGATGGGCTATGCTTGGAGCTCTTGGATGTGTCTTCCCTGAGCTTTTGGCTCGTAATGGTGTTAAGTTTGGCGAGGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E519196] SGN-U205577 Solanum melongena Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T320069 [Download] [View] Facility Assigned ID: cC-smflcSML7H10c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0233 Quality Trim Threshold: 20.5