Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E52028

Search information 
Request: 52028Match: SGN-E52028
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C44250Clone name: cLEG-67-H20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C44250 [cLEG-67-H20] Trace: SGN-T78902 EST: SGN-E264582 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E52028Length: 210 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E52028 [] (called/trimmed by facility)
ATCCCCCGGGCTGCATTTCCTAAATTGGCTTGCTTGGTCGGCTCAAGAATTTTAATGTAGCAAACAATCGATTGACTGGAGCAGTTCCACGTTTC
ACAAATGCAACTTTTCCTGCAGAGATCTATGCCAATAATGCCGGACTGTGTGGACCACCATTAACTCTTTGTGAGGATATTGCTAAGAAACCCCG
TACTGGAATCATTGTTGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T78902 [Download] [View] Facility Assigned ID: TBFKH46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence